Process of Recombinant DNA Technology- Isolation of DNA and its Amplification

Choose the option that is showing the correct sequence of events occurring in each cycle of polymerase chain reaction (PCR).

The source organisms that possess Taq polymerase are

As opposed to DNA replication within the cell, discontinuous synthesis of DNA does NOT occur in a polymerase chain reaction (PCR). Why?

How many of the following given in the box are included under downstream processing?

Small chemically synthesised oligonucleotides that are complementary to the regions of DNA are called primers and present at the

Given below are two statements about polymerase chain reactions.  

P) It mimics DNA replication that happens in a cell.

Q) It cannot be used to amplify RNA molecules.  

Assertion: Cells multiplied in a continuous culture system produce large biomass leading to high yields of desired proteins.

Reason: The added fresh medium maintains the cells in the most active exponential phase.

The correct option among the following is:

In a PRC reaction, only the reverse primer was omitted from the reaction mixture. How many single stranded (ss) and double stranded (ds) DNA molecules, excluding primer molecules, will be present in the mixture at the end of 5 cycles, given 10 molecules of double stranded DNA were used as template?

Choose the correct option that represents correct sequential steps for PCR method:

A well known technique to amplify a small portion of DNA is termed as

Transfer of rDNA through phage is done by

In a pathological lab, a series of steps were undertaken for finding the gene of interest. Describe the steps, or make a flow chart showing the process of amplification of this gene of interest.

A double-stranded DNA template with sequence $5\text{'}GCCATGAACTAGCTTCGATCGATGCTTGCCTACGTCAGTC3\text{'}$ was $PCR$-amplified using forward $\left(5\text{'}GAACTA3\text{'}\right)$ and reverse $\left(5\text{'}ACGTAG3\text{'}\right)$ primers. Given the size and sequence of the new $PCR$ fragment produced (Table), the correct combination from the options is

A polymerase chain reaction (PCR) for amplification of DNA fragments involves multiple cycles of thermal denaturation, annealing and extension steps in each cycle. Because of the heat denaturation step, a thermostable polymerase is required for performing PCR. An experimenter had all the resources except the thermostable DNA polymerase to perform a PCR. The experimenter can use _____ to substitute for thermostable DNA polymerase.

Describe briefly the following

Polymerase Chain Reaction (PCR)

Write short note on the following

Downstream Processing

Describe briefly downstreaming with diagram.

Describe briefly PCR with diagram.